Transcript: Mouse XR_387734.2

PREDICTED: Mus musculus hook microtubule tethering protein 2 (Hook2), transcript variant X10, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hook2 (170833)
Length:
2532
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_387734.2
NBCI Gene record:
Hook2 (170833)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_387734.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000111733 CTGTGCTATCAGTTGTGAGAA pLKO.1 495 3UTR 100% 4.950 3.465 N Hook2 n/a
2 TRCN0000316231 CTGTGCTATCAGTTGTGAGAA pLKO_005 495 3UTR 100% 4.950 3.465 N Hook2 n/a
3 TRCN0000111731 GCCTCACAGCTAAGAAGCTAT pLKO.1 872 3UTR 100% 4.950 3.465 N Hook2 n/a
4 TRCN0000349162 GCCTCACAGCTAAGAAGCTAT pLKO_005 872 3UTR 100% 4.950 3.465 N Hook2 n/a
5 TRCN0000111732 CACCAGAGAATTACGGGAATT pLKO.1 665 3UTR 100% 0.000 0.000 N Hook2 n/a
6 TRCN0000316233 CACCAGAGAATTACGGGAATT pLKO_005 665 3UTR 100% 0.000 0.000 N Hook2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_387734.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.