Transcript: Mouse XR_387748.2

PREDICTED: Mus musculus leucine rich repeat containing 36 (Lrrc36), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lrrc36 (270091)
Length:
2410
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_387748.2
NBCI Gene record:
Lrrc36 (270091)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_387748.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267594 GACACGGGTCAGTACCTAATA pLKO_005 2231 3UTR 100% 13.200 18.480 N Lrrc36 n/a
2 TRCN0000253151 TTCCGACTAAGAGGTCATTAA pLKO_005 1412 3UTR 100% 13.200 18.480 N Lrrc36 n/a
3 TRCN0000267623 GCGCTCGAAGCTTGACGATAA pLKO_005 1741 3UTR 100% 10.800 15.120 N Lrrc36 n/a
4 TRCN0000253152 AGGTCCCTGGTGGTAACTAAT pLKO_005 2069 3UTR 100% 13.200 9.240 N Lrrc36 n/a
5 TRCN0000253150 CTACCGAGAACATAGCATAAA pLKO_005 1107 3UTR 100% 13.200 9.240 N Lrrc36 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_387748.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08506 pDONR223 100% 78.8% None (many diffs) n/a
2 ccsbBroad304_08506 pLX_304 0% 78.8% V5 (many diffs) n/a
3 TRCN0000477949 CACCACCCGTAGACATTTTCTGTA pLX_317 12.9% 78.8% V5 (many diffs) n/a
Download CSV