Transcript: Mouse XR_387782.2

PREDICTED: Mus musculus ubiquitin specific peptidase 38 (Usp38), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Usp38 (74841)
Length:
2272
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_387782.2
NBCI Gene record:
Usp38 (74841)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_387782.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030878 CCATGTGATTGTCCCTCATAT pLKO.1 1639 3UTR 100% 13.200 9.240 N Usp38 n/a
2 TRCN0000030874 GCATGTAGATACGTGGGTAAT pLKO.1 1447 3UTR 100% 10.800 7.560 N Usp38 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_387782.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09209 pDONR223 100% 38.1% None (many diffs) n/a
2 ccsbBroad304_09209 pLX_304 0% 38.1% V5 (many diffs) n/a
3 TRCN0000474563 AGACACGTTATGTGACCCGCTCCC pLX_317 13.7% 38.1% V5 (many diffs) n/a
Download CSV