Transcript: Mouse XR_388553.3

PREDICTED: Mus musculus TBC1 domain family, member 9B (Tbc1d9b), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tbc1d9b (76795)
Length:
5257
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_388553.3
NBCI Gene record:
Tbc1d9b (76795)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_388553.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252496 ATTGAACAGATGCGGTTTAAA pLKO_005 2726 3UTR 100% 15.000 21.000 N Tbc1d9b n/a
2 TRCN0000252495 TGGCGAGACCTTCAAGCTTAT pLKO_005 1081 3UTR 100% 10.800 8.640 N Tbc1d9b n/a
3 TRCN0000258221 GCCTTCCGAAACCCTACTATT pLKO_005 2132 3UTR 100% 13.200 9.240 N Tbc1d9b n/a
4 TRCN0000252497 TCTTCCCAAGTCAGGTATATG pLKO_005 4552 3UTR 100% 13.200 9.240 N Tbc1d9b n/a
5 TRCN0000252498 TGAAGAGCTGGAGGATCTTTA pLKO_005 2833 3UTR 100% 13.200 9.240 N Tbc1d9b n/a
6 TRCN0000055508 CCAACCTGAAAGACCGTGATT pLKO.1 1512 3UTR 100% 4.950 2.970 N TBC1D9B n/a
7 TRCN0000331296 CCAACCTGAAAGACCGTGATT pLKO_005 1512 3UTR 100% 4.950 2.970 N TBC1D9B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_388553.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15748 pDONR223 0% 20% None (many diffs) n/a
2 ccsbBroad304_15748 pLX_304 0% 20% V5 (many diffs) n/a
Download CSV