Transcript: Mouse XR_390309.3

PREDICTED: Mus musculus solute carrier family 44, member 1 (Slc44a1), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc44a1 (100434)
Length:
4545
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_390309.3
NBCI Gene record:
Slc44a1 (100434)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_390309.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102053 CTGAGCTACTTAAACCAGAAT pLKO.1 1745 3UTR 100% 4.950 6.930 N Slc44a1 n/a
2 TRCN0000314316 CTGAGCTACTTAAACCAGAAT pLKO_005 1745 3UTR 100% 4.950 6.930 N Slc44a1 n/a
3 TRCN0000102052 CGAGAATTCTATATGGACAAA pLKO.1 2108 3UTR 100% 0.000 0.000 N Slc44a1 n/a
4 TRCN0000314246 CGAGAATTCTATATGGACAAA pLKO_005 2108 3UTR 100% 0.000 0.000 N Slc44a1 n/a
5 TRCN0000166130 CCATGCAACCTGGACTTGATA pLKO.1 557 3UTR 100% 5.625 4.500 N SLC44A1 n/a
6 TRCN0000159556 GCATTGGGATGGGATTTATTT pLKO.1 384 3UTR 100% 15.000 10.500 N SLC44A1 n/a
7 TRCN0000102051 GCATCAGTGAATCGCCTTATT pLKO.1 1556 3UTR 100% 13.200 9.240 N Slc44a1 n/a
8 TRCN0000314244 GCATCAGTGAATCGCCTTATT pLKO_005 1556 3UTR 100% 13.200 9.240 N Slc44a1 n/a
9 TRCN0000102054 CCTGGACTTGATAAACAGGAA pLKO.1 565 3UTR 100% 2.640 1.848 N Slc44a1 n/a
10 TRCN0000314314 CCTGGACTTGATAAACAGGAA pLKO_005 565 3UTR 100% 2.640 1.848 N Slc44a1 n/a
11 TRCN0000159306 GAAATGGTAGTGGATGTATTA pLKO.1 2039 3UTR 100% 13.200 9.240 N SLC44A1 n/a
12 TRCN0000166060 GAGCAGCTTCAGATAGCTGAA pLKO.1 1097 3UTR 100% 0.405 0.243 N SLC44A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_390309.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.