Transcript: Human XR_430072.3

PREDICTED: Homo sapiens rotatin (RTTN), transcript variant X10, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RTTN (25914)
Length:
6493
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_430072.3
NBCI Gene record:
RTTN (25914)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_430072.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433780 ATCAGCATTTCCCGCTAATAA pLKO_005 1822 3UTR 100% 15.000 21.000 N RTTN n/a
2 TRCN0000427392 TCCGTGTACTACCCGATTAAA pLKO_005 2324 3UTR 100% 15.000 21.000 N RTTN n/a
3 TRCN0000129465 GCTGATACAAAGCGTCCTCTA pLKO.1 2436 3UTR 100% 4.050 5.670 N RTTN n/a
4 TRCN0000431570 TTATCTAAGCTTCGGTCTAAT pLKO_005 336 3UTR 100% 13.200 9.240 N RTTN n/a
5 TRCN0000146856 CCCTGAAATCTTAACAGGATA pLKO.1 479 3UTR 100% 4.950 3.465 N RTTN n/a
6 TRCN0000150036 CGATTGATATGTTCTGCACAT pLKO.1 5389 3UTR 100% 4.050 2.835 N RTTN n/a
7 TRCN0000131036 CCCAAGATCCTGGCTAATGAA pLKO.1 6475 3UTR 100% 5.625 3.938 N RTTN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_430072.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.