Transcript: Mouse XR_865162.2

PREDICTED: Mus musculus minichromosome maintenance domain containing 2 (Mcmdc2), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mcmdc2 (240697)
Length:
9077
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_865162.2
NBCI Gene record:
Mcmdc2 (240697)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_865162.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264915 CTATCGGTTCAGTATTCTAAT pLKO_005 5669 3UTR 100% 13.200 10.560 N Mcmdc2 n/a
2 TRCN0000264914 GAGAAGACTGCTTGGATATTT pLKO_005 6571 3UTR 100% 15.000 10.500 N Mcmdc2 n/a
3 TRCN0000264913 CTTTGTGAGTTTCCACTTAAT pLKO_005 5895 3UTR 100% 13.200 9.240 N Mcmdc2 n/a
4 TRCN0000264912 GATGTTCACAGTCAGCTATAG pLKO_005 7499 3UTR 100% 10.800 6.480 N Mcmdc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_865162.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13302 pDONR223 100% 16.4% None (many diffs) n/a
2 ccsbBroad304_13302 pLX_304 0% 16.4% V5 (many diffs) n/a
3 TRCN0000472583 ACAAATATGGCAACAGGTCCCGTA pLX_317 22.4% 16.4% V5 (many diffs) n/a
Download CSV