Transcript: Mouse XR_866323.1

PREDICTED: Mus musculus proteoglycan 3 (Prg3), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prg3 (53856)
Length:
1770
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_866323.1
NBCI Gene record:
Prg3 (53856)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_866323.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099721 CCTTAAATAAGGACTCTGCTT pLKO.1 427 3UTR 100% 2.640 3.696 N Prg3 n/a
2 TRCN0000441101 TCAATCAGTCCATCGTCTGGA pLKO_005 637 3UTR 100% 2.640 3.696 N Prg3 n/a
3 TRCN0000099722 CCCGAGACATTTGATAAGGCT pLKO.1 525 3UTR 100% 0.750 1.050 N Prg3 n/a
4 TRCN0000099720 CCACAGTTATAGTTTCAACTA pLKO.1 590 3UTR 100% 4.950 3.465 N Prg3 n/a
5 TRCN0000435332 GGGTTCCCAACACCAAGACAT pLKO_005 368 3UTR 100% 4.950 3.465 N Prg3 n/a
6 TRCN0000444727 TGGCGAAGAGCTTCATGCAAA pLKO_005 798 3UTR 100% 4.950 3.465 N Prg3 n/a
7 TRCN0000099723 GCAATGGAGTCAGATCCAGAT pLKO.1 405 3UTR 100% 4.050 2.835 N Prg3 n/a
8 TRCN0000099724 GAGAATCCCAAGAGAGAGGAA pLKO.1 255 3UTR 100% 2.640 1.848 N Prg3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_866323.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.