Transcript: Mouse XR_867210.2

PREDICTED: Mus musculus mannosidase, beta A, lysosomal (Manba), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Manba (110173)
Length:
3811
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_867210.2
NBCI Gene record:
Manba (110173)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_867210.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304274 GCATCCAGTATGGTGATATTC pLKO_005 1661 3UTR 100% 13.200 18.480 N Manba n/a
2 TRCN0000077409 GCTCGATTAGTGTCTGAATAT pLKO.1 1732 3UTR 100% 13.200 18.480 N Manba n/a
3 TRCN0000301356 GCTCGATTAGTGTCTGAATAT pLKO_005 1732 3UTR 100% 13.200 18.480 N Manba n/a
4 TRCN0000077412 CGTGAACTGGTTCCACGTAAA pLKO.1 1476 3UTR 100% 10.800 15.120 N Manba n/a
5 TRCN0000301357 CGTGAACTGGTTCCACGTAAA pLKO_005 1476 3UTR 100% 10.800 15.120 N Manba n/a
6 TRCN0000310870 GGGAACTCAGATCCTACAATA pLKO_005 3236 3UTR 100% 13.200 9.240 N Manba n/a
7 TRCN0000077410 GCAGAAGGTAAAGTTGATCTT pLKO.1 366 3UTR 100% 4.950 3.465 N Manba n/a
8 TRCN0000301430 GCAGAAGGTAAAGTTGATCTT pLKO_005 366 3UTR 100% 4.950 3.465 N Manba n/a
9 TRCN0000077408 GCCTGAATGTTGTATCTGATT pLKO.1 3305 3UTR 100% 4.950 3.465 N Manba n/a
10 TRCN0000077411 GCTCCCTTTGTTTGGTTGGAT pLKO.1 2679 3UTR 100% 3.000 2.100 N Manba n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_867210.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.