Transcript: Mouse XR_867215.2

PREDICTED: Mus musculus BCLl2-like 15 (Bcl2l15), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bcl2l15 (229672)
Length:
2364
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_867215.2
NBCI Gene record:
Bcl2l15 (229672)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_867215.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294519 TGCACTCAGGATCCTACTTTA pLKO_005 2099 3UTR 100% 13.200 10.560 N Bcl2l15 n/a
2 TRCN0000009727 GCAAACAGAATGCATCGTGAA pLKO.1 1825 3UTR 100% 4.050 3.240 N Bcl2l15 n/a
3 TRCN0000294584 GCAAACAGAATGCATCGTGAA pLKO_005 1825 3UTR 100% 4.050 3.240 N Bcl2l15 n/a
4 TRCN0000009724 GCCAATAATATCATTGCGGTA pLKO.1 2012 3UTR 100% 2.160 1.728 N Bcl2l15 n/a
5 TRCN0000294585 ACACAGCCATCCGCGAGTTTA pLKO_005 2235 3UTR 100% 13.200 9.240 N Bcl2l15 n/a
6 TRCN0000009728 GCTGGAAGCTTCTGCCAATAA pLKO.1 1999 3UTR 100% 13.200 9.240 N Bcl2l15 n/a
7 TRCN0000294518 GCTGGAAGCTTCTGCCAATAA pLKO_005 1999 3UTR 100% 13.200 9.240 N Bcl2l15 n/a
8 TRCN0000009725 GCTCAGGAGAGGATTACTCTT pLKO.1 1920 3UTR 100% 4.950 3.465 N Bcl2l15 n/a
9 TRCN0000294583 GCTCAGGAGAGGATTACTCTT pLKO_005 1920 3UTR 100% 4.950 3.465 N Bcl2l15 n/a
10 TRCN0000009726 TCTTGAATATGTGGTCCGTAA pLKO.1 2158 3UTR 100% 4.050 2.835 N Bcl2l15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_867215.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.