Transcript: Mouse XR_871103.1

PREDICTED: Mus musculus solute carrier family 38, member 3 (Slc38a3), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc38a3 (76257)
Length:
2518
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_871103.1
NBCI Gene record:
Slc38a3 (76257)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_871103.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055365 CCCGTTTGATGTGCTGATCTT pLKO.1 1303 3UTR 100% 4.950 6.930 N Slc38a3 n/a
2 TRCN0000419198 GCCATCTTCTACTTCCGAATC pLKO_005 1568 3UTR 100% 6.000 4.200 N SLC38A3 n/a
3 TRCN0000055366 CCTCAACTCACAGACAGCATA pLKO.1 1013 3UTR 100% 4.950 3.465 N Slc38a3 n/a
4 TRCN0000055364 CGCAGTCATCTATAAGAAGTT pLKO.1 851 3UTR 100% 4.950 3.465 N Slc38a3 n/a
5 TRCN0000055363 CGTGCATCAATCTGCTGGTTA pLKO.1 1470 3UTR 100% 4.950 3.465 N Slc38a3 n/a
6 TRCN0000055367 CCTGTTGTCTAGCTATTCCAT pLKO.1 485 3UTR 100% 3.000 2.100 N Slc38a3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_871103.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.