Transcript: Mouse XR_871210.2

PREDICTED: Mus musculus golgi autoantigen, golgin subfamily a, 4 (Golga4), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Golga4 (54214)
Length:
8676
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_871210.2
NBCI Gene record:
Golga4 (54214)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_871210.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115341 CCTAGTTCTTTATGCTATGAT pLKO.1 8484 3UTR 100% 5.625 7.875 N Golga4 n/a
2 TRCN0000326616 CCTAGTTCTTTATGCTATGAT pLKO_005 8484 3UTR 100% 5.625 7.875 N Golga4 n/a
3 TRCN0000115342 GCAGCAAGAATCCTTGGCTTT pLKO.1 2043 3UTR 100% 4.050 5.670 N Golga4 n/a
4 TRCN0000354185 GCAGCAAGAATCCTTGGCTTT pLKO_005 2043 3UTR 100% 4.050 5.670 N Golga4 n/a
5 TRCN0000061991 CGTGATGCAAAGAACTTAATT pLKO.1 1498 3UTR 100% 15.000 10.500 N GOLGA4 n/a
6 TRCN0000286364 CGTGATGCAAAGAACTTAATT pLKO_005 1498 3UTR 100% 15.000 10.500 N GOLGA4 n/a
7 TRCN0000115343 CCCAGCACCAAAGCACTATTA pLKO.1 4799 3UTR 100% 13.200 9.240 N Golga4 n/a
8 TRCN0000326615 CCCAGCACCAAAGCACTATTA pLKO_005 4799 3UTR 100% 13.200 9.240 N Golga4 n/a
9 TRCN0000306337 GACTTAGAGACTGCGTTAAAG pLKO_005 4981 3UTR 100% 13.200 9.240 N Golga4 n/a
10 TRCN0000115345 GCCATCCTTACAGAGAGTGAA pLKO.1 2089 3UTR 100% 4.950 3.465 N Golga4 n/a
11 TRCN0000115344 CCATAATTTAGAAGACCGTTT pLKO.1 6822 3UTR 100% 4.050 2.835 N Golga4 n/a
12 TRCN0000326551 CCATAATTTAGAAGACCGTTT pLKO_005 6822 3UTR 100% 4.050 2.835 N Golga4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_871210.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.