Transcript: Mouse XR_872537.2

PREDICTED: Mus musculus RIKEN cDNA 3110053B16 gene (3110053B16Rik), misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
3110053B16Rik (382686)
Length:
1682
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_872537.2
NBCI Gene record:
3110053B16Rik (382686)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_872537.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053956 GCCAAGAGTGACCCATCCATT pLKO.1 859 3UTR 100% 4.950 2.970 N HPCAL4 n/a
2 TRCN0000243551 CAAGAAGAAATGAAAGGTTTA pLKO_005 262 3UTR 100% 10.800 5.400 Y Gm9222 n/a
3 TRCN0000095842 GACATTGTCAAAGTTCAAGAA pLKO.1 247 3UTR 100% 4.950 2.475 Y 2410018L13Rik n/a
4 TRCN0000186940 GACTGTGGACAATTTCAAGAT pLKO.1 429 3UTR 100% 4.950 2.475 Y LOC382716 n/a
5 TRCN0000056324 ACCTTTGACACCAACAGCGAT pLKO.1 508 3UTR 100% 2.640 1.320 Y HPCA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_872537.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.