Transcript: Mouse XR_875811.2

PREDICTED: Mus musculus NLR family, CARD domain containing 3 (Nlrc3), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nlrc3 (268857)
Length:
6727
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_875811.2
NBCI Gene record:
Nlrc3 (268857)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_875811.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175237 CAGCTACAGAAGAACTTAATT pLKO.1 6029 3UTR 100% 15.000 10.500 N Nlrc3 n/a
2 TRCN0000362599 GCAACCTCTTTCCAGAAATTT pLKO_005 3515 3UTR 100% 15.000 10.500 N Nlrc3 n/a
3 TRCN0000249398 AGCTCTACTCTTGGTACTTTA pLKO_005 3836 3UTR 100% 13.200 9.240 N Nlrc3 n/a
4 TRCN0000362735 TGGCAGCTACATATTACTATA pLKO_005 4136 3UTR 100% 13.200 9.240 N Nlrc3 n/a
5 TRCN0000249399 ACTGGGTTTCCTCGCCCATTT pLKO_005 4215 3UTR 100% 10.800 7.560 N Nlrc3 n/a
6 TRCN0000176177 GAGCAATTCCATCAGTGACAT pLKO.1 6214 3UTR 100% 4.950 3.465 N Nlrc3 n/a
7 TRCN0000168383 GTGAACAGAACCTTGGAGATT pLKO.1 6702 3UTR 100% 4.950 3.465 N NLRC3 n/a
8 TRCN0000249397 CCCTGACAACCTTAGACTTAC pLKO_005 6544 3UTR 100% 10.800 6.480 N Nlrc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_875811.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.