Transcript: Mouse XR_878316.1

PREDICTED: Mus musculus transmembrane protein 37 (Tmem37), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem37 (170706)
Length:
1140
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_878316.1
NBCI Gene record:
Tmem37 (170706)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_878316.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247212 CTCCTCCTGGTTGCCTTTATC pLKO_005 731 3UTR 100% 13.200 9.240 N Tmem37 n/a
2 TRCN0000257632 GATAGGTTAGTCATGCTATTA pLKO_005 1084 3UTR 100% 13.200 9.240 N Tmem37 n/a
3 TRCN0000247209 GCTTACAGAAAGCGAGGTTAT pLKO_005 932 3UTR 100% 10.800 7.560 N Tmem37 n/a
4 TRCN0000247210 TAGGACCTCTGGCTGAGATTG pLKO_005 971 3UTR 100% 10.800 7.560 N Tmem37 n/a
5 TRCN0000247211 TCGGCTTGGAGATGCTCATTG pLKO_005 654 3UTR 100% 10.800 7.560 N Tmem37 n/a
6 TRCN0000174657 GTCTTTCTTTGAGTCCTTCAT pLKO.1 394 3UTR 100% 4.950 3.465 N Tmem37 n/a
7 TRCN0000174885 GAGATTGAATAGGACAACCAA pLKO.1 985 3UTR 100% 3.000 2.100 N Tmem37 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_878316.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.