Transcript: Mouse XR_879554.2

PREDICTED: Mus musculus cyclin-dependent kinase-like 3 (Cdkl3), transcript variant X36, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cdkl3 (213084)
Length:
3271
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_879554.2
NBCI Gene record:
Cdkl3 (213084)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_879554.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322369 ATATGATGTTCCTAGGTTAAA pLKO_005 3079 3UTR 100% 13.200 18.480 N Cdkl3 n/a
2 TRCN0000023138 CCTTCCTAGCAGTTCCGATTT pLKO.1 1340 3UTR 100% 10.800 15.120 N Cdkl3 n/a
3 TRCN0000322368 CCTTCCTAGCAGTTCCGATTT pLKO_005 1340 3UTR 100% 10.800 15.120 N Cdkl3 n/a
4 TRCN0000023136 CCGCACCTGCACAATATCTTT pLKO.1 1404 3UTR 100% 5.625 7.875 N Cdkl3 n/a
5 TRCN0000023137 GCAACGAGAGAAATAAAGTTT pLKO.1 879 3UTR 100% 5.625 7.875 N Cdkl3 n/a
6 TRCN0000322367 GCAACGAGAGAAATAAAGTTT pLKO_005 879 3UTR 100% 5.625 7.875 N Cdkl3 n/a
7 TRCN0000023134 CGCCATTGAGTACCTGCATAA pLKO.1 1073 3UTR 100% 10.800 7.560 N Cdkl3 n/a
8 TRCN0000195070 CTTTGGGCTGTATGATCATTG pLKO.1 1297 3UTR 100% 10.800 7.560 N CDKL3 n/a
9 TRCN0000023135 CGGTCATGAAATGCAAACATA pLKO.1 790 3UTR 100% 5.625 3.938 N Cdkl3 n/a
10 TRCN0000322366 CGGTCATGAAATGCAAACATA pLKO_005 790 3UTR 100% 5.625 3.938 N Cdkl3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_879554.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.