Transcript: Mouse XR_879563.2

PREDICTED: Mus musculus solute carrier family 36 (proton/amino acid symporter), member 1 (Slc36a1), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc36a1 (215335)
Length:
4499
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_879563.2
NBCI Gene record:
Slc36a1 (215335)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_879563.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008701 CCTGCAATTTGGAGCTAATAT pLKO.1 1104 3UTR 100% 15.000 21.000 N SLC36A1 n/a
2 TRCN0000229647 CCTGCAATTTGGAGCTAATAT pLKO_005 1104 3UTR 100% 15.000 21.000 N SLC36A1 n/a
3 TRCN0000068378 CGGTGATGTATGGACTAGAAT pLKO.1 527 3UTR 100% 5.625 7.875 N Slc36a1 n/a
4 TRCN0000068382 CGGACAACTTTAAGCAGGTGA pLKO.1 659 3UTR 100% 2.640 3.696 N Slc36a1 n/a
5 TRCN0000068379 GCTGTACTCCATAGGCATCTT pLKO.1 1182 3UTR 100% 4.950 3.465 N Slc36a1 n/a
6 TRCN0000068380 CCTGATCATGATATACCAGTT pLKO.1 864 3UTR 100% 4.050 2.835 N Slc36a1 n/a
7 TRCN0000068381 CCTACTATGGAGAGGGCATTA pLKO.1 1439 3UTR 100% 10.800 5.400 Y Slc36a1 n/a
8 TRCN0000229645 GCATGGGTATCCTGGTGAAAT pLKO_005 452 3UTR 100% 13.200 9.240 N SLC36A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_879563.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.