Transcript: Human XR_924913.3

PREDICTED: Homo sapiens family with sequence similarity 53 member A (FAM53A), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM53A (152877)
Length:
2800
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_924913.3
NBCI Gene record:
FAM53A (152877)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_924913.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121931 CTTGGAACATTAAGGCGTAAT pLKO.1 2656 3UTR 100% 10.800 15.120 N FAM53A n/a
2 TRCN0000434846 GAACAAGAGCGGTCGTCTGTT pLKO_005 994 3UTR 100% 4.950 6.930 N FAM53A n/a
3 TRCN0000146779 CTCAATTACGAAGATGACGAT pLKO.1 1808 3UTR 100% 2.640 3.696 N FAM53A n/a
4 TRCN0000122684 GCACAGAGTAGGTTTCGTGTT pLKO.1 2634 3UTR 100% 4.050 2.835 N FAM53A n/a
5 TRCN0000122125 GCTTGGAACATTAAGGCGTAA pLKO.1 2655 3UTR 100% 4.050 2.835 N FAM53A n/a
6 TRCN0000428146 AGGGCACAGAGTAGGTTTCCT pLKO_005 2507 3UTR 100% 3.000 2.100 N FAM53A n/a
7 TRCN0000431347 CTCACACCATGGGTCTTCAGT pLKO_005 1131 3UTR 100% 3.000 2.100 N FAM53A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_924913.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05068 pDONR223 100% 42.6% None 1_895del;2090_2800del n/a
2 ccsbBroad304_05068 pLX_304 0% 42.6% V5 1_895del;2090_2800del n/a
Download CSV