Transcript: Human XR_927138.2

PREDICTED: Homo sapiens uncharacterized LOC105375210 (LOC105375210), ncRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC105375210 (105375210)
Length:
1258
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_927138.2
NBCI Gene record:
LOC105375210 (105375210)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_927138.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 1075 3UTR 100% 4.950 2.475 Y ORAI2 n/a
2 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 997 3UTR 100% 4.950 2.475 Y ERAP2 n/a
3 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 998 3UTR 100% 13.200 6.600 Y LIAS n/a
4 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 1072 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_927138.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.