Transcript: Human XR_929780.2

PREDICTED: Homo sapiens anaphase promoting complex subunit 2 (ANAPC2), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANAPC2 (29882)
Length:
2723
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_929780.2
NBCI Gene record:
ANAPC2 (29882)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_929780.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272869 TGCGCGGAGTCTTGTTCTTTA pLKO_005 523 3UTR 100% 13.200 18.480 N ANAPC2 n/a
2 TRCN0000010870 GCGGCGTTCATCGGACATCAT pLKO.1 1538 3UTR 100% 1.650 2.310 N ANAPC2 n/a
3 TRCN0000284875 GCGGCGTTCATCGGACATCAT pLKO_005 1538 3UTR 100% 1.650 2.310 N ANAPC2 n/a
4 TRCN0000272870 TGCTTCTTGAGAGTCTATATG pLKO_005 588 3UTR 100% 13.200 10.560 N ANAPC2 n/a
5 TRCN0000272871 AGGCGGTGATCTTGCTGTATT pLKO_005 2041 3UTR 100% 13.200 9.240 N ANAPC2 n/a
6 TRCN0000004360 CCTCTATATCTCTGCCATCAA pLKO.1 1247 3UTR 100% 4.950 3.465 N ANAPC2 n/a
7 TRCN0000004357 GCAGATTAAAGCAAGTCAGAT pLKO.1 2699 3UTR 100% 4.950 3.465 N ANAPC2 n/a
8 TRCN0000272936 GCAGATTAAAGCAAGTCAGAT pLKO_005 2699 3UTR 100% 4.950 3.465 N ANAPC2 n/a
9 TRCN0000004358 GCTGCTCTTCTGGACGTACAT pLKO.1 2349 3UTR 100% 4.950 3.465 N ANAPC2 n/a
10 TRCN0000004359 CCCGGCACCTTCTCTGTCATT pLKO.1 2224 3UTR 100% 1.650 1.155 N ANAPC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_929780.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08129 pDONR223 100% 90.4% None (many diffs) n/a
Download CSV