Transcript: Human XR_929797.2

PREDICTED: Homo sapiens coiled-coil domain containing 187 (CCDC187), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC187 (399693)
Length:
3380
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_929797.2
NBCI Gene record:
CCDC187 (399693)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_929797.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164812 CGAGAAAGTCATAGCTGCCAA pLKO.1 1244 3UTR 100% 2.640 3.696 N CCDC187 n/a
2 TRCN0000166239 CCATGACAGAGAGGAAGCATT pLKO.1 1555 3UTR 100% 4.950 3.465 N CCDC187 n/a
3 TRCN0000160973 GACAAACACAAAGACGAAGAT pLKO.1 1083 3UTR 100% 4.950 3.465 N CCDC187 n/a
4 TRCN0000165903 GACTTAGGAGACAGCGAGAAA pLKO.1 1230 3UTR 100% 4.950 3.465 N CCDC187 n/a
5 TRCN0000165227 GCGGCCAAAGACAAACACAAA pLKO.1 1074 3UTR 100% 4.950 3.465 N CCDC187 n/a
6 TRCN0000165739 CAGAGCTCCTTCTCTAAGAGT pLKO.1 1527 3UTR 100% 3.000 2.100 N CCDC187 n/a
7 TRCN0000166240 CAGAGAGGAAGCATTCCTCTT pLKO.1 1561 3UTR 100% 0.405 0.284 N CCDC187 n/a
8 TRCN0000165254 GTGTTTGAACAGAGCCTGGAA pLKO.1 2501 3UTR 100% 2.640 1.584 N CCDC187 n/a
9 TRCN0000163526 GAGAGGAAGCATTCCTCTTTA pLKO.1 1563 3UTR 100% 1.320 0.792 N CCDC187 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_929797.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.