Transcript: Human XR_929864.3

PREDICTED: Homo sapiens cell division cycle 14B (CDC14B), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDC14B (8555)
Length:
2056
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_929864.3
NBCI Gene record:
CDC14B (8555)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_929864.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381974 GTGATAGACTTCGGGCCTTGA pLKO_005 1216 3UTR 100% 4.050 5.670 N CDC14B n/a
2 TRCN0000380135 ACTGATGCCATTGTCAAAGAA pLKO_005 807 3UTR 100% 5.625 3.375 N CDC14B n/a
3 TRCN0000005979 CTCCTGAGACTTATATTCAAT pLKO.1 664 3UTR 100% 5.625 3.375 N CDC14B n/a
4 TRCN0000273454 CTCCTGAGACTTATATTCAAT pLKO_005 664 3UTR 100% 5.625 3.375 N CDC14B n/a
5 TRCN0000273457 CACAATGTTACTACCATTATT pLKO_005 696 3UTR 100% 15.000 7.500 Y CDC14B n/a
6 TRCN0000273455 TTGGATGCTACATGGTTATAT pLKO_005 340 3UTR 100% 15.000 7.500 Y CDC14B n/a
7 TRCN0000005978 GAGTGCATCAAATGTACATTA pLKO.1 131 3UTR 100% 13.200 6.600 Y CDC14B n/a
8 TRCN0000284982 GGATAATACCAGACCGATTTA pLKO_005 586 3UTR 100% 13.200 6.600 Y CDC14B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_929864.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.