Transcript: Human XR_930494.1

PREDICTED: Homo sapiens myosin IIIA (MYO3A), transcript variant X10, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MYO3A (53904)
Length:
4645
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_930494.1
NBCI Gene record:
MYO3A (53904)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_930494.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196424 GAGCCTCTAATTGCCTATATT pLKO.1 574 3UTR 100% 15.000 21.000 N MYO3A n/a
2 TRCN0000002200 GCACTTTCTGACCACCCTAAT pLKO.1 415 3UTR 100% 10.800 15.120 N MYO3A n/a
3 TRCN0000195167 CGTGGAGCAGTTAAATCTAAT pLKO.1 3336 3UTR 100% 13.200 9.240 N MYO3A n/a
4 TRCN0000195293 CTTGATCCAATTCACGATATT pLKO.1 358 3UTR 100% 13.200 9.240 N MYO3A n/a
5 TRCN0000002198 CCCATTACAAACTGCCTGAAA pLKO.1 1832 3UTR 100% 4.950 3.465 N MYO3A n/a
6 TRCN0000002197 CCTGATGGATTTGTTGTCTAA pLKO.1 3003 3UTR 100% 4.950 3.465 N MYO3A n/a
7 TRCN0000002201 GCGGTATTCATTCAGAGCAAA pLKO.1 4252 3UTR 100% 4.950 3.465 N MYO3A n/a
8 TRCN0000226053 GGCAATGCCTGCACTATTATA pLKO_005 1624 3UTR 100% 15.000 9.000 N Myo3a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_930494.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.