Transcript: Human XR_930883.2

PREDICTED: Homo sapiens protein tyrosine phosphatase receptor type J (PTPRJ), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTPRJ (5795)
Length:
3975
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_930883.2
NBCI Gene record:
PTPRJ (5795)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_930883.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000320604 TGATTCCGGGCACCTTATATA pLKO_005 2196 3UTR 100% 15.000 21.000 N PTPRJ n/a
2 TRCN0000320555 ACGAGTCGTCATCTAACTATA pLKO_005 1581 3UTR 100% 13.200 18.480 N PTPRJ n/a
3 TRCN0000002871 CCGATACAATGCCACCGTTTA pLKO.1 1426 3UTR 100% 10.800 15.120 N PTPRJ n/a
4 TRCN0000320600 CCGATACAATGCCACCGTTTA pLKO_005 1426 3UTR 100% 10.800 15.120 N PTPRJ n/a
5 TRCN0000002869 CCACACAAGCACGTATGACAA pLKO.1 2155 3UTR 100% 4.950 6.930 N PTPRJ n/a
6 TRCN0000380380 GCACGTATGACAAAGCGATTA pLKO_005 2163 3UTR 100% 10.800 8.640 N PTPRJ n/a
7 TRCN0000002870 GCCATAGAGTTCAGGACAAAT pLKO.1 1484 3UTR 100% 13.200 9.240 N PTPRJ n/a
8 TRCN0000320602 TCCGAGTATGTCTACCATTTA pLKO_005 2108 3UTR 100% 13.200 9.240 N PTPRJ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_930883.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.