Transcript: Human XR_931960.3

PREDICTED: Homo sapiens solute carrier family 12 member 6 (SLC12A6), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC12A6 (9990)
Length:
5444
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_931960.3
NBCI Gene record:
SLC12A6 (9990)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_931960.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042954 CCGAAACTCAATGCTACGATT pLKO.1 4339 3UTR 100% 4.950 6.930 N SLC12A6 n/a
2 TRCN0000042953 CGGACATAAGAAAGCTCGAAA pLKO.1 1571 3UTR 100% 4.950 6.930 N SLC12A6 n/a
3 TRCN0000042956 GCTAAATAACATGCGTGTCTA pLKO.1 2192 3UTR 100% 4.950 6.930 N SLC12A6 n/a
4 TRCN0000417234 TGAAACTCAACGAGGTTATAG pLKO_005 4542 3UTR 100% 13.200 9.240 N SLC12A6 n/a
5 TRCN0000042957 CCCATGAAGCAAAGCTGGTTT pLKO.1 4572 3UTR 100% 4.950 3.465 N SLC12A6 n/a
6 TRCN0000042955 CCGGTTTGCTTTGCTTCGATT pLKO.1 3464 3UTR 100% 4.950 3.465 N SLC12A6 n/a
7 TRCN0000069260 CCATTGAAATCTTTCTGGTAT pLKO.1 2110 3UTR 100% 4.950 2.970 N Slc12a6 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5170 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_931960.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15687 pDONR223 0% 51.8% None (many diffs) n/a
Download CSV