Transcript: Human XR_934047.2

PREDICTED: Homo sapiens phosphoribosylformylglycinamidine synthase (PFAS), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PFAS (5198)
Length:
3180
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_934047.2
NBCI Gene record:
PFAS (5198)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_934047.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036213 GTTGCCATTGAAGCCAGTAAT pLKO.1 1279 3UTR 100% 13.200 18.480 N PFAS n/a
2 TRCN0000036211 CGAGACTGAACTGTGCTACAA pLKO.1 246 3UTR 100% 4.950 3.960 N PFAS n/a
3 TRCN0000287002 CGAGACTGAACTGTGCTACAA pLKO_005 246 3UTR 100% 4.950 3.960 N PFAS n/a
4 TRCN0000036210 GCCAGGCATGGAAGTTGTAAA pLKO.1 1470 3UTR 100% 13.200 9.240 N PFAS n/a
5 TRCN0000287001 GCCAGGCATGGAAGTTGTAAA pLKO_005 1470 3UTR 100% 13.200 9.240 N PFAS n/a
6 TRCN0000036212 CTGTGATAACAGCAGTGCAAT pLKO.1 945 3UTR 100% 4.950 2.970 N PFAS n/a
7 TRCN0000287000 CTGTGATAACAGCAGTGCAAT pLKO_005 945 3UTR 100% 4.950 2.970 N PFAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_934047.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06711 pDONR223 100% 73.1% None (many diffs) n/a
2 ccsbBroad304_06711 pLX_304 0% 73.1% V5 (many diffs) n/a
Download CSV