Transcript: Human XR_934423.2

PREDICTED: Homo sapiens zinc finger protein 652 (ZNF652), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF652 (22834)
Length:
5030
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_934423.2
NBCI Gene record:
ZNF652 (22834)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_934423.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000297719 GCACATGAACGTTACTCATAG pLKO_005 1198 3UTR 100% 10.800 15.120 N ZNF652 n/a
2 TRCN0000156002 CCTGTCCACCAAAGTGTACAA pLKO.1 547 3UTR 100% 4.950 6.930 N ZNF652 n/a
3 TRCN0000279618 CCTGTCCACCAAAGTGTACAA pLKO_005 547 3UTR 100% 4.950 6.930 N ZNF652 n/a
4 TRCN0000152970 GACATGCCATTTACATGCGAA pLKO.1 1472 3UTR 100% 2.640 3.696 N ZNF652 n/a
5 TRCN0000188593 GAGCAGATCATAGTGGAGGTA pLKO.1 755 3UTR 100% 2.640 3.696 N Zfp652 n/a
6 TRCN0000151480 CGCATGCAGATTTGTGATAAA pLKO.1 1220 3UTR 100% 13.200 10.560 N ZNF652 n/a
7 TRCN0000279635 CGCATGCAGATTTGTGATAAA pLKO_005 1220 3UTR 100% 13.200 10.560 N ZNF652 n/a
8 TRCN0000187880 GCAGATCATAGTGGAGGTAAA pLKO.1 757 3UTR 100% 10.800 8.640 N Zfp652 n/a
9 TRCN0000278523 TAGTGGAGGTAAACCTTAATA pLKO_005 765 3UTR 100% 15.000 10.500 N ZNF652 n/a
10 TRCN0000154051 CCACTGAACTAAAGCCCAATT pLKO.1 2440 3UTR 100% 10.800 7.560 N ZNF652 n/a
11 TRCN0000153625 CCAAAGAGACTCCTGTTCTTA pLKO.1 834 3UTR 100% 5.625 3.938 N ZNF652 n/a
12 TRCN0000187739 GCAAGAAGTTTGTCCTGGAAA pLKO.1 1245 3UTR 100% 4.950 3.465 N Zfp652 n/a
13 TRCN0000153154 GAGCATTCATATTGGGCACAA pLKO.1 1624 3UTR 100% 4.050 2.835 N ZNF652 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_934423.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.