Transcript: Human XR_936641.2

PREDICTED: Homo sapiens solute carrier family 2 member 10 (SLC2A10), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC2A10 (81031)
Length:
4353
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_936641.2
NBCI Gene record:
SLC2A10 (81031)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_936641.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265759 TCTCCTATGCCCTCAACTATG pLKO_005 632 3UTR 100% 10.800 15.120 N SLC2A10 n/a
2 TRCN0000042842 GATGGTCTTTGTCAGTGCCTT pLKO.1 1434 3UTR 100% 2.640 3.696 N SLC2A10 n/a
3 TRCN0000042838 GCCTGGGCTTCATCTATTTAT pLKO.1 1701 3UTR 100% 15.000 10.500 N SLC2A10 n/a
4 TRCN0000265768 CTACACATCAGGGCTTGATTT pLKO_005 3693 3UTR 100% 13.200 9.240 N SLC2A10 n/a
5 TRCN0000265744 CTGTGGTTGGCTTCGCCATTT pLKO_005 503 3UTR 100% 10.800 7.560 N SLC2A10 n/a
6 TRCN0000256169 TCTCCTTCCTCGATCTCATTG pLKO_005 1626 3UTR 100% 10.800 7.560 N SLC2A10 n/a
7 TRCN0000042840 CATCTTCAGCTCCGTTGGTTT pLKO.1 954 3UTR 100% 4.950 3.465 N SLC2A10 n/a
8 TRCN0000042839 GCTTGCTGTATCTACGTGTCA pLKO.1 538 3UTR 100% 2.640 1.848 N SLC2A10 n/a
9 TRCN0000042841 GTTATGAACTGGCAGTCATAT pLKO.1 254 3UTR 100% 1.320 0.924 N SLC2A10 n/a
10 TRCN0000079417 TGCTGTATCTACGTGTCAGAA pLKO.1 541 3UTR 100% 4.950 3.465 N Slc2a10 n/a
11 TRCN0000079415 GCTGTATCTACGTGTCAGAAT pLKO.1 542 3UTR 100% 4.950 6.930 N Slc2a10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_936641.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04229 pDONR223 100% 37.2% None (many diffs) n/a
2 ccsbBroad304_04229 pLX_304 0% 37.2% V5 (many diffs) n/a
Download CSV