Transcript: Human XR_938710.3

PREDICTED: Homo sapiens RUN and FYVE domain containing 3 (RUFY3), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RUFY3 (22902)
Length:
4189
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_938710.3
NBCI Gene record:
RUFY3 (22902)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_938710.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130334 GACGGTCAGATTACTGCAATT pLKO.1 1191 3UTR 100% 10.800 15.120 N RUFY3 n/a
2 TRCN0000413280 TACGATTGGATGTTGAGAAAG pLKO_005 1495 3UTR 100% 10.800 15.120 N RUFY3 n/a
3 TRCN0000129998 GCTGCTACCATTAAACAACTT pLKO.1 1740 3UTR 100% 4.950 6.930 N RUFY3 n/a
4 TRCN0000129032 GAACTAAACAGTCGCTTGGAA pLKO.1 1701 3UTR 100% 3.000 4.200 N RUFY3 n/a
5 TRCN0000426833 CAAGCATGAACTTGCCTTTAA pLKO_005 1643 3UTR 100% 13.200 9.240 N RUFY3 n/a
6 TRCN0000127915 CCTGGCTTCGTTTGGCATTAA pLKO.1 925 3UTR 100% 13.200 9.240 N RUFY3 n/a
7 TRCN0000417785 GAGTTCAGACTTAGGAGTAAA pLKO_005 1670 3UTR 100% 13.200 9.240 N RUFY3 n/a
8 TRCN0000421501 TTGCAAACAACAGGATCATTA pLKO_005 1333 3UTR 100% 13.200 9.240 N RUFY3 n/a
9 TRCN0000438447 AGGACGGGAACAGCAGTAAAG pLKO_005 1159 3UTR 100% 10.800 7.560 N RUFY3 n/a
10 TRCN0000130549 GCTTGATTGAATCAGCTCTGA pLKO.1 676 3UTR 100% 2.640 1.584 N RUFY3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_938710.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.