Transcript: Human XR_939697.3

PREDICTED: Homo sapiens metastasis associated 1 family member 3 (MTA3), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MTA3 (57504)
Length:
4581
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_939697.3
NBCI Gene record:
MTA3 (57504)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_939697.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231171 CACTTACGGATCGACAGATTG pLKO_005 594 3UTR 100% 10.800 15.120 N Mta3 n/a
2 TRCN0000016459 GCGGATGCTAACAACTCCAAA pLKO.1 1714 3UTR 100% 4.950 6.930 N MTA3 n/a
3 TRCN0000231173 ACGGCCGTTTGTTGCTATTAA pLKO_005 1516 3UTR 100% 15.000 12.000 N Mta3 n/a
4 TRCN0000016458 GCAGTGTAGATTATGTGCAAT pLKO.1 1228 3UTR 100% 4.950 3.960 N MTA3 n/a
5 TRCN0000081872 CGGCCGTTTGTTGCTATTAAT pLKO.1 1517 3UTR 100% 15.000 10.500 N Mta3 n/a
6 TRCN0000016462 GCATGTATCATTGGGTATTTA pLKO.1 1625 3UTR 100% 15.000 10.500 N MTA3 n/a
7 TRCN0000016460 GCTGAGAGTAAACTGAAACAA pLKO.1 1022 3UTR 100% 5.625 3.375 N MTA3 n/a
8 TRCN0000016461 CCCTTCTGAATGAGACAGAAT pLKO.1 369 3UTR 100% 0.495 0.297 N MTA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_939697.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.