Transcript: Human XR_943406.3

PREDICTED: Homo sapiens REST corepressor 1 (RCOR1), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RCOR1 (23186)
Length:
5760
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_943406.3
NBCI Gene record:
RCOR1 (23186)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_943406.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418894 ACAACCACCTAAGTGATAATA pLKO_005 2166 3UTR 100% 15.000 21.000 N RCOR1 n/a
2 TRCN0000417862 ACTAGACATGGAATTGGTTTC pLKO_005 1314 3UTR 100% 6.000 8.400 N RCOR1 n/a
3 TRCN0000071368 CGCCGCTTCAACATAGATGAA pLKO.1 1521 3UTR 100% 4.950 3.960 N Rcor1 n/a
4 TRCN0000301882 CGCCGCTTCAACATAGATGAA pLKO_005 1521 3UTR 100% 4.950 3.960 N Rcor1 n/a
5 TRCN0000147184 CCCAATAATGGCCAGAATAAA pLKO.1 487 3UTR 100% 15.000 10.500 N RCOR1 n/a
6 TRCN0000129660 CAAACGACAGATCCAGAATAT pLKO.1 1338 3UTR 100% 13.200 9.240 N RCOR1 n/a
7 TRCN0000417168 GGATGCTCTTCTGGCATAAAC pLKO_005 800 3UTR 100% 13.200 9.240 N RCOR1 n/a
8 TRCN0000427948 GTGCTCCATCTGCCTTAATTC pLKO_005 1835 3UTR 100% 13.200 9.240 N RCOR1 n/a
9 TRCN0000425035 TATCCGGGATATCAGGTATTA pLKO_005 1735 3UTR 100% 13.200 9.240 N RCOR1 n/a
10 TRCN0000414931 AGACAAACAGTGCTCTCAAAG pLKO_005 1364 3UTR 100% 10.800 7.560 N RCOR1 n/a
11 TRCN0000149968 CAGACAAACAGTGCTCTCAAA pLKO.1 1363 3UTR 100% 4.950 3.465 N RCOR1 n/a
12 TRCN0000071371 GTCTTATTTGAGCAAGCCTTT pLKO.1 895 3UTR 100% 4.050 2.835 N Rcor1 n/a
13 TRCN0000147902 GTCTTATTTGAGCAAGCCTTT pLKO.1 895 3UTR 100% 4.050 2.835 N RCOR1 n/a
14 TRCN0000301950 GTCTTATTTGAGCAAGCCTTT pLKO_005 895 3UTR 100% 4.050 2.835 N Rcor1 n/a
15 TRCN0000128570 GATGGTGGAATAGAACCATAT pLKO.1 1393 3UTR 100% 1.080 0.756 N RCOR1 n/a
16 TRCN0000146866 CGCTTCAACATAGATGAAGTT pLKO.1 1524 3UTR 100% 0.495 0.347 N RCOR1 n/a
17 TRCN0000128260 GCAAATGGAAACAATCCCATT pLKO.1 1093 3UTR 100% 0.405 0.284 N RCOR1 n/a
18 TRCN0000147106 CTATAGCAAGTCTGGTGAAAT pLKO.1 968 3UTR 100% 13.200 7.920 N RCOR1 n/a
19 TRCN0000147486 GTTGGATGAATACATTGCCAT pLKO.1 738 3UTR 100% 2.640 1.584 N RCOR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_943406.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.