Transcript: Human XR_944651.1

PREDICTED: Homo sapiens protein tyrosine phosphatase receptor type B (PTPRB), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTPRB (5787)
Length:
4142
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_944651.1
NBCI Gene record:
PTPRB (5787)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_944651.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382161 CCGCAACCGAGTATCGATTTA pLKO_005 3305 3UTR 100% 13.200 18.480 N PTPRB n/a
2 TRCN0000381060 TCAGCCAGGAGTGACTATTTA pLKO_005 2923 3UTR 100% 15.000 10.500 N PTPRB n/a
3 TRCN0000002840 CCCGGAGATGTGGATAACTAT pLKO.1 2701 3UTR 100% 5.625 3.938 N PTPRB n/a
4 TRCN0000002841 GCCACCACTAAGCAACACAAA pLKO.1 3832 3UTR 100% 4.950 3.465 N PTPRB n/a
5 TRCN0000320453 GCCACCACTAAGCAACACAAA pLKO_005 3832 3UTR 100% 4.950 3.465 N PTPRB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_944651.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11076 pDONR223 100% 55.7% None (many diffs) n/a
2 ccsbBroad304_11076 pLX_304 0% 55.7% V5 (many diffs) n/a
Download CSV