Transcript: Human XR_944714.2

PREDICTED: Homo sapiens nucleolar complex associated 4 homolog (NOC4L), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NOC4L (79050)
Length:
1625
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_944714.2
NBCI Gene record:
NOC4L (79050)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_944714.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122579 CCTCTGTCTTTCACGTCAAGT pLKO.1 1014 3UTR 100% 4.950 6.930 N NOC4L n/a
2 TRCN0000280890 CCTCTGTCTTTCACGTCAAGT pLKO_005 1014 3UTR 100% 4.950 6.930 N NOC4L n/a
3 TRCN0000148675 CTCTGTCTTTCACGTCAAGTA pLKO.1 1015 3UTR 100% 4.950 3.960 N NOC4L n/a
4 TRCN0000122580 CCTGCCTTTCATCTGTAACCT pLKO.1 1168 3UTR 100% 3.000 2.100 N NOC4L n/a
5 TRCN0000280892 CCTGCCTTTCATCTGTAACCT pLKO_005 1168 3UTR 100% 3.000 2.100 N NOC4L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_944714.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.