Transcript: Human XR_946560.3

PREDICTED: Homo sapiens dihydrolipoamide branched chain transacylase E2 (DBT), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DBT (1629)
Length:
1106
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_946560.3
NBCI Gene record:
DBT (1629)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_946560.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221427 CCTTCATTCAAGTATAGTCAT pLKO.1 144 3UTR 100% 4.950 3.960 N DBT n/a
2 TRCN0000319135 CCTTCATTCAAGTATAGTCAT pLKO_005 144 3UTR 100% 4.950 3.960 N DBT n/a
3 TRCN0000221426 GCTGCTTCCTTGGGATTACTA pLKO.1 1042 3UTR 100% 5.625 3.938 N DBT n/a
4 TRCN0000319137 GCTGCTTCCTTGGGATTACTA pLKO_005 1042 3UTR 100% 5.625 3.938 N DBT n/a
5 TRCN0000221424 CCAAGAGATAAAGGGCCGAAA pLKO.1 506 3UTR 100% 4.050 2.835 N DBT n/a
6 TRCN0000319136 CCAAGAGATAAAGGGCCGAAA pLKO_005 506 3UTR 100% 4.050 2.835 N DBT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_946560.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.