Transcript: Human XR_946642.2

PREDICTED: Homo sapiens bone morphogenetic protein 8a (BMP8A), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BMP8A (353500)
Length:
1505
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_946642.2
NBCI Gene record:
BMP8A (353500)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_946642.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058276 AGGGAGTCTGACTTGTTCTTT pLKO.1 886 3UTR 100% 5.625 2.813 Y BMP8A n/a
2 TRCN0000058275 CATTGGAAGGAGTTCCGCTTT pLKO.1 733 3UTR 100% 4.050 2.025 Y BMP8A n/a
3 TRCN0000058491 CCATTGGAAGGAGTTCCGCTT pLKO.1 732 3UTR 100% 2.160 1.080 Y BMP8B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_946642.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.