Transcript: Human XR_948242.2

PREDICTED: Homo sapiens cardiomyopathy associated 5 (CMYA5), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CMYA5 (202333)
Length:
12998
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_948242.2
NBCI Gene record:
CMYA5 (202333)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_948242.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257128 CTATCACGAACCCAGATATTT pLKO_005 9694 3UTR 100% 15.000 21.000 N CMYA5 n/a
2 TRCN0000218398 TTACCTGCACAATCATCTATA pLKO_005 3658 3UTR 100% 13.200 18.480 N CMYA5 n/a
3 TRCN0000230194 TCATTCCTTTAGGTGCTATAC pLKO_005 12446 3UTR 100% 10.800 15.120 N CMYA5 n/a
4 TRCN0000129695 CCAACCCAATGATAACTACTT pLKO.1 11776 3UTR 100% 4.950 6.930 N CMYA5 n/a
5 TRCN0000129294 CGAGCAGTTGCTCTTCATCAT pLKO.1 12259 3UTR 100% 4.950 6.930 N CMYA5 n/a
6 TRCN0000230192 TTGAGCCTGATTCACTATTAA pLKO_005 3263 3UTR 100% 15.000 10.500 N CMYA5 n/a
7 TRCN0000129552 CCAGTGAAAGGGCCATCTTTA pLKO.1 11559 3UTR 100% 13.200 9.240 N CMYA5 n/a
8 TRCN0000230193 TAACCTCCAACCCAATGATAA pLKO_005 11770 3UTR 100% 13.200 9.240 N CMYA5 n/a
9 TRCN0000130845 GACTACAACAACCAGAGACTT pLKO.1 12218 3UTR 100% 4.950 3.465 N CMYA5 n/a
10 TRCN0000128399 GAAGAGAAACTCTCAAAGGAA pLKO.1 9436 3UTR 100% 3.000 2.100 N CMYA5 n/a
11 TRCN0000376851 GTCTACCTCAGAGGTGTTAAG pLKO_005 4752 3UTR 100% 10.800 8.640 N Cmya5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_948242.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.