Transcript: Human XR_949471.3

PREDICTED: Homo sapiens WRN RecQ like helicase (WRN), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WRN (7486)
Length:
4819
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_949471.3
NBCI Gene record:
WRN (7486)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_949471.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427430 GAGGGTTTCTATCTTACTAAA pLKO_005 1138 3UTR 100% 13.200 18.480 N WRN n/a
2 TRCN0000240193 GGACCCAACACTTGATCATTT pLKO_005 1342 3UTR 100% 13.200 18.480 N LOC652522 n/a
3 TRCN0000426872 TACTTAGCGACATGAACAAAC pLKO_005 1038 3UTR 100% 10.800 15.120 N WRN n/a
4 TRCN0000240196 GGTAGAAGTTTCTCGGTATAA pLKO_005 3385 3UTR 100% 13.200 10.560 N LOC652522 n/a
5 TRCN0000004902 CCTGTTTATGTAGGCAAGATT pLKO.1 2054 3UTR 100% 5.625 4.500 N WRN n/a
6 TRCN0000367441 ATGGAGTGGCCACCATTATAC pLKO_005 548 3UTR 100% 13.200 9.240 N WRN n/a
7 TRCN0000367463 CAGCGTCTTGCCGATCAATAT pLKO_005 3275 3UTR 100% 13.200 9.240 N WRN n/a
8 TRCN0000004900 CGTTGCTTAAATCTGAGAAAT pLKO.1 2447 3UTR 100% 13.200 9.240 N WRN n/a
9 TRCN0000240197 GTAATGAGAAGTTTCGATTAT pLKO_005 2952 3UTR 100% 13.200 9.240 N LOC652522 n/a
10 TRCN0000423185 TACGTGACTTTGATATCAAAT pLKO_005 744 3UTR 100% 13.200 9.240 N WRN n/a
11 TRCN0000240194 TCAGCGTCTTGCCGATCAATA pLKO_005 3274 3UTR 100% 13.200 9.240 N LOC652522 n/a
12 TRCN0000419144 AGATATTAGCATGAGTCTATC pLKO_005 502 3UTR 100% 10.800 7.560 N WRN n/a
13 TRCN0000004901 CCATTATACAATAGAGGGAAA pLKO.1 560 3UTR 100% 4.050 2.835 N WRN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_949471.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.