Transcript: Human XR_950871.2

PREDICTED: Homo sapiens CD19 molecule (CD19), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CD19 (930)
Length:
1169
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_950871.2
NBCI Gene record:
CD19 (930)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_950871.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057692 CTTCAACGTCTCTCAACAGAT pLKO.1 297 3UTR 100% 4.950 6.930 N CD19 n/a
2 TRCN0000417717 TCAAGACGCTGGAAAGTATTA pLKO_005 804 3UTR 100% 13.200 9.240 N CD19 n/a
3 TRCN0000057688 CCTAAGTCATTGCTGAGCCTA pLKO.1 709 3UTR 100% 2.640 1.848 N CD19 n/a
4 TRCN0000057690 TGGGCATTCTTCATCTTCAAA pLKO.1 968 3UTR 100% 5.625 3.375 N CD19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_950871.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00250 pDONR223 99% 65.6% None 1_45del;988_989ins49;1169_1170ins495 n/a
2 ccsbBroad304_00250 pLX_304 0% 65.6% V5 (not translated due to prior stop codon) 1_45del;988_989ins49;1169_1170ins495 n/a
Download CSV