Vector: pLKO_016

View vector index

Vector Information:

Vector Name:
pLKO_016
Alias:
pLKO_TRC016
Pol II Cassette 1:
PGK-BlastR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
1.9 KB Stuffer
Selection Marker:
BlastR
Visible Reporter:
n/a
Cloning Site:
1.9 KB Stuffer

Sequence Data Files

For a free vector file viewer, try ApE or SnapGene Viewer.

GenBank[?] FASTA SnapGene[?] Revision Notes
1 GB FASTA n/a 2017-04-12: Sequence verified as correct.
Download CSV

Control Clones

Clone ID Target Seq Target Gene ID Target Gene Symbol Taxon Target Region Notes
1 TRCN0000559397 ACAACAGCCACAACGTCTATA GFP GFP CONTROL CDS
2 TRCN0000559387 (no hairpin) n/a n/a n/a
Download CSV