Vector: pLKO_017

View vector index

Vector Information:

Vector Name:
pLKO_017
Alias:
pLKO_TRC017
Pol II Cassette 1:
PGK-NeoR
Pol II Cassette 2:
n/a
Pol III Promoter:
constitutive hU6
Pol III Insert:
1.9 KB Stuffer
Selection Marker:
NeoR
Visible Reporter:
n/a
Cloning Site:
1.9 KB Stuffer

Sequence Data Files

For a free vector file viewer, try ApE or SnapGene Viewer.

GenBank[?] FASTA SnapGene[?] Revision Notes
1 GB FASTA DNA 2017-04-12: Sequence corrected; changes unlikely to have functional consequences
2 GB FASTA n/a (original version)
Download CSV

Control Clones

Clone ID Target Seq Target Gene ID Target Gene Symbol Taxon Target Region Notes
1 TRCN0000559407 ACAACAGCCACAACGTCTATA GFP GFP CONTROL CDS
Download CSV