Transcript: Mouse NM_013834.3

Mus musculus secreted frizzled-related protein 1 (Sfrp1), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Sfrp1 (20377)
Length:
4389
CDS:
284..1228

Additional Resources:

NCBI RefSeq record:
NM_013834.3
NBCI Gene record:
Sfrp1 (20377)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_013834.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034483 CGAGTACGACTACGTGAGCTT pLKO.1 379 CDS 100% 2.640 3.696 N Sfrp1 n/a
2 TRCN0000363844 ACGTTGTTCGGGACATCATTA pLKO_005 1603 3UTR 100% 13.200 9.240 N Sfrp1 n/a
3 TRCN0000348829 ACTGGCCCGAGATGCTCAAAT pLKO_005 732 CDS 100% 13.200 9.240 N Sfrp1 n/a
4 TRCN0000375633 CAATTGCTTGTGGAGTCTAAG pLKO_005 1625 3UTR 100% 10.800 7.560 N Sfrp1 n/a
5 TRCN0000348830 TGAAGTCAGAGGCCATCATTG pLKO_005 861 CDS 100% 10.800 7.560 N Sfrp1 n/a
6 TRCN0000034481 CATTCACAAGTGGGACAAGAA pLKO.1 1132 CDS 100% 4.950 3.465 N Sfrp1 n/a
7 TRCN0000375634 CCACAACGTGGGCTACAAGAA pLKO_005 487 CDS 100% 4.950 3.465 N Sfrp1 n/a
8 TRCN0000034479 GCTTGTGCTGTTCCTGAAGAA pLKO.1 1018 CDS 100% 4.950 3.465 N Sfrp1 n/a
9 TRCN0000352143 GCTTGTGCTGTTCCTGAAGAA pLKO_005 1018 CDS 100% 4.950 3.465 N Sfrp1 n/a
10 TRCN0000034480 GCTCAACAAGAACTGCCACAT pLKO.1 583 CDS 100% 4.050 2.835 N Sfrp1 n/a
11 TRCN0000352142 GCTCAACAAGAACTGCCACAT pLKO_005 583 CDS 100% 4.050 2.835 N Sfrp1 n/a
12 TRCN0000034482 TCATTGAACATCTCTGTGCAA pLKO.1 876 CDS 100% 2.640 1.848 N Sfrp1 n/a
13 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1749 3UTR 100% 4.950 2.475 Y KAAG1 n/a
14 TRCN0000172440 CACACACACACACACAGACAA pLKO.1 3475 3UTR 100% 4.950 2.475 Y LINC00955 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013834.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01520 pDONR223 100% 92.4% 94.9% None (many diffs) n/a
2 ccsbBroad304_01520 pLX_304 0% 92.4% 94.9% V5 (many diffs) n/a
3 TRCN0000477245 ACTTTGCTCGTTGTCCGTAGAATT pLX_317 38.9% 92.4% 94.9% V5 (many diffs) n/a
Download CSV