Transcript: Human XM_011527608.2

PREDICTED: Homo sapiens SH2 domain containing 3A (SH2D3A), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SH2D3A (10045)
Length:
2812
CDS:
847..2379

Additional Resources:

NCBI RefSeq record:
XM_011527608.2
NBCI Gene record:
SH2D3A (10045)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011527608.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072872 GCCTGCAGATTTGGCACATAT pLKO.1 1005 CDS 100% 13.200 18.480 N SH2D3A n/a
2 TRCN0000072870 CGCTGAACGCTTTGAGAAGTT pLKO.1 2310 CDS 100% 4.950 3.960 N SH2D3A n/a
3 TRCN0000072869 CGGCTCTGGTTCACAGTTATA pLKO.1 827 5UTR 100% 13.200 9.240 N SH2D3A n/a
4 TRCN0000072871 AGCCTGCAGATTTGGCACATA pLKO.1 1004 CDS 100% 4.950 3.465 N SH2D3A n/a
5 TRCN0000072868 CAAATGTGACTCCACCTCTTA pLKO.1 2580 3UTR 100% 4.950 3.465 N SH2D3A n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 12 5UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 12 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011527608.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.