Transcript: Mouse XM_017322010.1

PREDICTED: Mus musculus MYC-associated zinc finger protein (purine-binding transcription factor) (Maz), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Maz (17188)
Length:
1570
CDS:
135..1565

Additional Resources:

NCBI RefSeq record:
XM_017322010.1
NBCI Gene record:
Maz (17188)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322010.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235699 GATGCTGAGCTCGGCTTATAT pLKO_005 1331 CDS 100% 15.000 21.000 N MAZ n/a
2 TRCN0000238893 GATGCTGAGCTCGGCTTATAT pLKO_005 1331 CDS 100% 15.000 21.000 N Maz n/a
3 TRCN0000015344 CGGCCCTTCAAATGTGAGAAA pLKO.1 1224 CDS 100% 4.950 6.930 N MAZ n/a
4 TRCN0000238896 CTACCACCTGAACCGACATAA pLKO_005 1007 CDS 100% 13.200 10.560 N Maz n/a
5 TRCN0000238894 GGCCCTTCAAATGTGAGAAAT pLKO_005 1225 CDS 100% 13.200 9.240 N Maz n/a
6 TRCN0000235703 TCTGTGAGCTCTGCAACAAAG pLKO_005 1393 CDS 100% 10.800 7.560 N MAZ n/a
7 TRCN0000238895 TCTGTGAGCTCTGCAACAAAG pLKO_005 1393 CDS 100% 10.800 7.560 N Maz n/a
8 TRCN0000235701 AGTTCAAGAACGGCTACAATC pLKO_005 727 CDS 100% 10.800 7.560 N MAZ n/a
9 TRCN0000015345 GAGTTCAAGAACGGCTACAAT pLKO.1 726 CDS 100% 5.625 3.938 N MAZ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322010.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10960 pDONR223 100% 43.2% 41.1% None (many diffs) n/a
2 ccsbBroad304_10960 pLX_304 0% 43.2% 41.1% V5 (many diffs) n/a
3 TRCN0000476919 CCCTCATAAATTTTCTTTCAAATC pLX_317 49% 43.2% 41.1% V5 (many diffs) n/a
Download CSV