Construct: ORF TRCN0000465209
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004908.1_s317c1
- Derived from:
- ccsbBroadEn_06714
- DNA Barcode:
- CCAAGAGATCCAATCTGACACCAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PFKFB1 (5207)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465209
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5207 | PFKFB1 | 6-phosphofructo-2-kinase/fr... | NM_002625.4 | 99.9% | 99.7% | 1207T>C |
| 2 | human | 5207 | PFKFB1 | 6-phosphofructo-2-kinase/fr... | NM_001271804.2 | 95.2% | 95.1% | 221_222ins66;1141T>C |
| 3 | human | 5207 | PFKFB1 | 6-phosphofructo-2-kinase/fr... | XM_024452389.1 | 94.6% | 93.2% | (many diffs) |
| 4 | human | 5207 | PFKFB1 | 6-phosphofructo-2-kinase/fr... | XM_017029576.1 | 94.1% | 94% | 1_24del;246_308del;1294T>C |
| 5 | human | 5207 | PFKFB1 | 6-phosphofructo-2-kinase/fr... | XM_017029578.1 | 86.9% | 86.7% | 0_1ins129;93_155del;1141T>C |
| 6 | human | 5207 | PFKFB1 | 6-phosphofructo-2-kinase/fr... | XM_017029577.1 | 85.9% | 82.7% | (many diffs) |
| 7 | human | 5207 | PFKFB1 | 6-phosphofructo-2-kinase/fr... | NM_001271805.1 | 85.7% | 84.7% | (many diffs) |
| 8 | human | 5207 | PFKFB1 | 6-phosphofructo-2-kinase/fr... | NR_073450.2 | 64.6% | (many diffs) | |
| 9 | mouse | 18639 | Pfkfb1 | 6-phosphofructo-2-kinase/fr... | XM_006528755.2 | 91.2% | 95.3% | (many diffs) |
| 10 | mouse | 18639 | Pfkfb1 | 6-phosphofructo-2-kinase/fr... | NM_008824.3 | 86.3% | 89.1% | (many diffs) |
| 11 | mouse | 18639 | Pfkfb1 | 6-phosphofructo-2-kinase/fr... | XM_011247791.2 | 86.3% | 89.1% | (many diffs) |
| 12 | mouse | 18639 | Pfkfb1 | 6-phosphofructo-2-kinase/fr... | XM_006528756.3 | 70.9% | 73.6% | (many diffs) |
| 13 | mouse | 18639 | Pfkfb1 | 6-phosphofructo-2-kinase/fr... | XM_006528757.3 | 42.4% | 42.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1482
- ORF length:
- 1413
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtctccagag atgggagagc tcacccaaac caggttgcag aagatctgga 121 ttccacacag cagcggcagc agcaggctgc aacggagaag gggctcatcc ataccccagt 181 ttaccaattc ccccacaatg gtgatcatgg tgggtttacc agctcgaggc aagacctata 241 tctccacaaa gctcacacga tatctcaact ggataggaac accaactaaa gtgtttaatt 301 taggccagta tcgacgagag gcagtgagct acaagaacta tgaattcttt cttccagaca 361 acatggaagc cctgcaaatc aggaagcagt gcgccctggc agccctgaag gatgttcaca 421 actatctcag ccatgaggaa ggtcatgttg cggtttttga tgccaccaac actaccagag 481 aacgacggtc actgatcctg cagtttgcaa aagaacatgg ttacaaggtg tttttcattg 541 agtccatttg taatgaccct ggcataattg cagaaaacat caggcaagtg aaacttggca 601 gccctgatta tatagactgt gaccgggaaa aggttctgga agactttcta aagagaattg 661 agtgctatga ggtcaactac caacccttgg atgaggaact ggacagccac ctgtcctaca 721 tcaagatctt cgacgtgggc acacgctaca tggtgaaccg agtgcaggat cacatccaga 781 gccgcacagt ctactacctc atgaatatcc atgtcacacc tcgctccatc tacctttgcc 841 gacatggcga gagtgaactc aacatcagag gccgcatcgg aggtgactct ggcctctcag 901 ttcgcggcaa gcagtatgcc tatgccctgg ccaacttcat tcagtcccag ggcatcagct 961 ccctgaaggt gtggaccagt cacatgaaga ggaccatcca gacagctgag gccctgggtg 1021 tcccctatga gcagtggaag gccctgaatg agattgatgc gggtgtctgt gaggagatga 1081 cctatgaaga aatccaggaa cattaccctg aagaatttgc actgcgagac caagataaat 1141 atcgctaccg ctatcccaag ggagagtcct atgaggatct ggttcagcgt ctggagccag 1201 tgataatgga gctagaacga caggagaatg tactggtgat ctgccaccag gctgtcatgc 1261 ggtgccTCCT GGCCCATTTC CTGGATAAAA GTTCAGATGA GCTTCCATAT CTCAAGTGCC 1321 CTCTGCACAC AGTGCTCAAA CTCACTCCTG TGGCTTATGG CTGCAAAGTG GAATCCATCT 1381 ACCTGAATGT GGAGGCCGTG AACACACACC GGGAGAAGCC TGAGAATGTG GACATCACCC 1441 GGGAACCTGA GGAAGCCCTG GATACTGTCC CAGCCCACTA CTTGCCAACT TTCTTGTACA 1501 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1561 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1621 AGGACGACCA AGAGATCCAA TCTGACACCA CACGCGTTAA GTCgacaatc aacctctgga 1681 ttacaaaatt tgtgaaagat t