Transcript: Mouse XM_006528756.3

PREDICTED: Mus musculus 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 (Pfkfb1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pfkfb1 (18639)
Length:
1600
CDS:
425..1528

Additional Resources:

NCBI RefSeq record:
XM_006528756.3
NBCI Gene record:
Pfkfb1 (18639)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006528756.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000025628 CACCGACTAAAGTGTTTAATT pLKO.1 636 CDS 100% 15.000 21.000 N Pfkfb1 n/a
2 TRCN0000285235 CACCGACTAAAGTGTTTAATT pLKO_005 636 CDS 100% 15.000 21.000 N Pfkfb1 n/a
3 TRCN0000285232 CATGTCACACCTCGATCTATC pLKO_005 1166 CDS 100% 10.800 15.120 N Pfkfb1 n/a
4 TRCN0000025624 GCCAACTTCATTCGGTCTCAA pLKO.1 1286 CDS 100% 4.950 6.930 N Pfkfb1 n/a
5 TRCN0000274491 CTACGGGACCAGGATAAATAT pLKO_005 1478 CDS 100% 15.000 12.000 N Pfkfb1 n/a
6 TRCN0000025626 CATGGTTACAAGGTCTTCTTT pLKO.1 872 CDS 100% 5.625 4.500 N Pfkfb1 n/a
7 TRCN0000285234 CAACATGGAGGCCCAACTTAT pLKO_005 715 CDS 100% 13.200 9.240 N Pfkfb1 n/a
8 TRCN0000025627 CCACCTGTCCTACATCAAGAT pLKO.1 1063 CDS 100% 4.950 3.465 N Pfkfb1 n/a
9 TRCN0000037593 CTAAAGAGAATTGAGTGCTAT pLKO.1 1004 CDS 100% 4.950 2.970 N PFKFB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006528756.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06714 pDONR223 100% 70.9% 73.6% None (many diffs) n/a
2 TRCN0000465209 CCAAGAGATCCAATCTGACACCAC pLX_317 15.7% 70.9% 73.6% V5 (many diffs) n/a
Download CSV