Construct: ORF TRCN0000465230
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015957.1_s317c1
- Derived from:
- ccsbBroadEn_09956
- DNA Barcode:
- ATGACCTGTCCGCCTTCAGTTGTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KCTD1 (284252)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465230
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 284252 | KCTD1 | potassium channel tetrameri... | NM_001136205.2 | 99.8% | 100% | 90G>A |
| 2 | human | 284252 | KCTD1 | potassium channel tetrameri... | NM_001258221.1 | 99.8% | 100% | 90G>A |
| 3 | human | 284252 | KCTD1 | potassium channel tetrameri... | NM_001351443.1 | 99.8% | 100% | 90G>A |
| 4 | human | 284252 | KCTD1 | potassium channel tetrameri... | NM_198991.3 | 99.8% | 100% | 90G>A |
| 5 | human | 284252 | KCTD1 | potassium channel tetrameri... | NM_001258222.3 | 96.8% | 96.9% | 1_24del;114G>A |
| 6 | human | 284252 | KCTD1 | potassium channel tetrameri... | NM_001142730.3 | 29.6% | 29.7% | 1_1824del;1914G>A |
| 7 | mouse | 106931 | Kctd1 | potassium channel tetrameri... | XM_006525485.4 | 91.5% | 100% | (many diffs) |
| 8 | mouse | 106931 | Kctd1 | potassium channel tetrameri... | NM_134112.5 | 88.8% | 96.9% | (many diffs) |
| 9 | mouse | 106931 | Kctd1 | potassium channel tetrameri... | NM_001142731.1 | 27.3% | 29.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 837
- ORF length:
- 771
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc aagacctctg atcactagat cccctgcatc tccactgaac aaccaaggca 121 tccctactcc agcacaactc acaaaatcca atgcacctgt ccacattgat gtgggcggcc 181 acatgtacac cagcagcctg gccaccctca ccaaataccc tgaatccaga atcggaagac 241 tttttgatgg tacagagccc attgttttgg acagtctcaa acagcactat ttcattgaca 301 gagatggaca gatgttcaga tatatcttga attttctacg aacatccaaa ctcctcattc 361 ctgatgattt caaggactac actttgttat atgaagaggc aaaatatttt cagcttcagc 421 ccatgttgtt ggagatggaa agatggaagc aggacagaga aactggtcga ttttcaaggc 481 cctgtgagtg cctcgtcgtg cgtgtggccc cagacctcgg agaaaggatc acgctaagcg 541 gtgacaaatc cttgatagaa gaagtatttc cagagatcgg cgacgtgatg tgtaactctg 601 tcaatgcagg ctGGAATCAC GACTCGACGC ACGTCATCAG GTTTCCACTA AATGGCTACT 661 GTCACCTCAA CTCAGTCCAG GTCCTCGAGA GGTTGCAGCA AAGAGGATTT GAAATCGTGG 721 GCTCCTGTGG GGGAGGAGTA GACTCGTCCC AGTTCAGCGA ATACGTCCTT CGGCGGGAAC 781 TGAGGCGGAC GCCCCGTGTA CCCTCCGTCA TCCGGATAAA GCAAGAGCCT CTGGACTACC 841 CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT CCCTAACCCT CTCCTCGGTC 901 TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG TATTTCGATT TCTTGGCTTT 961 ATATATCTTG TGGAAAGGAC GAATGACCTG TCCGCCTTCA GTTGTTACGC GTTAAGTCga 1021 caatcaacct ctggattaca aaatttgtga aagatt