Transcript: Human NM_198991.3

Homo sapiens potassium channel tetramerization domain containing 1 (KCTD1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-02-23
Taxon:
Homo sapiens (human)
Gene:
KCTD1 (284252)
Length:
1754
CDS:
141..914

Additional Resources:

NCBI RefSeq record:
NM_198991.3
NBCI Gene record:
KCTD1 (284252)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198991.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420245 GTGATATCCTCAAGGTGTAAA pLKO_005 1090 3UTR 100% 13.200 18.480 N KCTD1 n/a
2 TRCN0000420597 TATGGAGGTTCCACGTCTTTC pLKO_005 1391 3UTR 100% 10.800 15.120 N KCTD1 n/a
3 TRCN0000044187 TCGACGCACGTCATCAGGTTT pLKO.1 699 CDS 100% 4.950 6.930 N KCTD1 n/a
4 TRCN0000044186 CAGTTCAGCGAATACGTCCTT pLKO.1 825 CDS 100% 2.640 3.696 N KCTD1 n/a
5 TRCN0000044183 CGTGATGTGTAACTCTGTCAA pLKO.1 659 CDS 100% 4.950 3.960 N KCTD1 n/a
6 TRCN0000376226 AGTCTCAAACAGCACTATTTC pLKO_005 348 CDS 100% 13.200 9.240 N Kctd1 n/a
7 TRCN0000044184 CCCTCACCAAATACCCTGAAT pLKO.1 280 CDS 100% 4.950 3.465 N KCTD1 n/a
8 TRCN0000044185 CCCATGTTGTTGGAGATGGAA pLKO.1 495 CDS 100% 3.000 2.100 N KCTD1 n/a
9 TRCN0000069089 CCTGATGATTTCAAGGACTAT pLKO.1 435 CDS 100% 4.950 3.465 N Kctd1 n/a
10 TRCN0000069088 CCACTGAACAACCAAGGCATT pLKO.1 177 CDS 100% 4.050 2.835 N Kctd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198991.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09956 pDONR223 100% 99.8% 100% None 90G>A n/a
2 ccsbBroad304_09956 pLX_304 0% 99.8% 100% V5 90G>A n/a
3 TRCN0000465230 ATGACCTGTCCGCCTTCAGTTGTT pLX_317 29.7% 99.8% 100% V5 90G>A n/a
Download CSV