Transcript: Mouse NM_001142731.1

Mus musculus potassium channel tetramerisation domain containing 1 (Kctd1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-02-20
Taxon:
Mus musculus (mouse)
Gene:
Kctd1 (106931)
Length:
3456
CDS:
19..2604

Additional Resources:

NCBI RefSeq record:
NM_001142731.1
NBCI Gene record:
Kctd1 (106931)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001142731.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069090 CGGTCGCAAGTTCGTTTACTT pLKO.1 1026 CDS 100% 5.625 7.875 N Kctd1 n/a
2 TRCN0000367037 GTCGCTTGGGCCTTACCATAA pLKO_005 1050 CDS 100% 10.800 8.640 N Kctd1 n/a
3 TRCN0000367036 TACCCTCAGTCATCCGGATAA pLKO_005 2564 CDS 100% 0.000 0.000 N Kctd1 n/a
4 TRCN0000376226 AGTCTCAAACAGCACTATTTC pLKO_005 2038 CDS 100% 13.200 9.240 N Kctd1 n/a
5 TRCN0000376225 ATGATATCCTCAAGATGTAAA pLKO_005 2777 3UTR 100% 13.200 9.240 N Kctd1 n/a
6 TRCN0000069092 CGGTTGCAGCAAAGAGGATTT pLKO.1 2455 CDS 100% 10.800 7.560 N Kctd1 n/a
7 TRCN0000069089 CCTGATGATTTCAAGGACTAT pLKO.1 2125 CDS 100% 4.950 3.465 N Kctd1 n/a
8 TRCN0000069091 GCTGTCCAAGACCTACACTAA pLKO.1 1332 CDS 100% 4.950 3.465 N Kctd1 n/a
9 TRCN0000069088 CCACTGAACAACCAAGGCATT pLKO.1 1867 CDS 100% 4.050 2.835 N Kctd1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001142731.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09956 pDONR223 100% 27.3% 29.8% None (many diffs) n/a
2 ccsbBroad304_09956 pLX_304 0% 27.3% 29.8% V5 (many diffs) n/a
3 TRCN0000465230 ATGACCTGTCCGCCTTCAGTTGTT pLX_317 29.7% 27.3% 29.8% V5 (many diffs) n/a
Download CSV