Construct: ORF TRCN0000465239
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003203.1_s317c1
- Derived from:
- ccsbBroadEn_14239
- DNA Barcode:
- CTTAGCCTAGCTGATTATTTGTTA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CELF5 (60680)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465239
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 60680 | CELF5 | CUGBP Elav-like family memb... | NM_001172673.2 | 86.5% | 70% | (many diffs) |
| 2 | human | 60680 | CELF5 | CUGBP Elav-like family memb... | NM_021938.4 | 82.6% | 68.3% | (many diffs) |
| 3 | human | 60680 | CELF5 | CUGBP Elav-like family memb... | XM_006722832.1 | 82.6% | 68.3% | (many diffs) |
| 4 | human | 60680 | CELF5 | CUGBP Elav-like family memb... | XM_006722833.1 | 82.4% | 68.1% | (many diffs) |
| 5 | human | 60680 | CELF5 | CUGBP Elav-like family memb... | XR_001753733.1 | 66.7% | (many diffs) | |
| 6 | human | 60680 | CELF5 | CUGBP Elav-like family memb... | XM_006722836.2 | 60.5% | 45.9% | (many diffs) |
| 7 | human | 60680 | CELF5 | CUGBP Elav-like family memb... | XM_006722837.4 | 59.2% | 45.6% | (many diffs) |
| 8 | human | 60680 | CELF5 | CUGBP Elav-like family memb... | XM_006722838.4 | 59.2% | 45.6% | (many diffs) |
| 9 | human | 60680 | CELF5 | CUGBP Elav-like family memb... | XM_011528173.1 | 59.2% | 45.6% | (many diffs) |
| 10 | human | 60680 | CELF5 | CUGBP Elav-like family memb... | XM_011528174.3 | 58.9% | 45.4% | (many diffs) |
| 11 | human | 60680 | CELF5 | CUGBP Elav-like family memb... | NR_033342.2 | 55.1% | (many diffs) | |
| 12 | human | 60680 | CELF5 | CUGBP Elav-like family memb... | XM_017027111.1 | 54% | 40.6% | (many diffs) |
| 13 | human | 60680 | CELF5 | CUGBP Elav-like family memb... | XR_430147.1 | 33.8% | (many diffs) | |
| 14 | mouse | 319586 | Celf5 | CUGBP, Elav-like family mem... | NM_176954.3 | 74.4% | 65.3% | (many diffs) |
| 15 | mouse | 319586 | Celf5 | CUGBP, Elav-like family mem... | NM_001311124.1 | 74.2% | 65.1% | (many diffs) |
| 16 | mouse | 319586 | Celf5 | CUGBP, Elav-like family mem... | XM_011243472.2 | 66.9% | 58.6% | (many diffs) |
| 17 | mouse | 319586 | Celf5 | CUGBP, Elav-like family mem... | XM_006513743.3 | 66.7% | 58.4% | (many diffs) |
| 18 | mouse | 319586 | Celf5 | CUGBP, Elav-like family mem... | NM_001311127.1 | 58.7% | 49.4% | (many diffs) |
| 19 | mouse | 319586 | Celf5 | CUGBP, Elav-like family mem... | NM_001311126.1 | 58.5% | 49.2% | (many diffs) |
| 20 | mouse | 319586 | Celf5 | CUGBP, Elav-like family mem... | XM_006513744.3 | 57.3% | 45.4% | (many diffs) |
| 21 | mouse | 319586 | Celf5 | CUGBP, Elav-like family mem... | XM_006513747.1 | 52.9% | 44.5% | (many diffs) |
| 22 | mouse | 319586 | Celf5 | CUGBP, Elav-like family mem... | XM_006513749.3 | 52.8% | 44.3% | (many diffs) |
| 23 | mouse | 319586 | Celf5 | CUGBP, Elav-like family mem... | XM_006513748.3 | 52.7% | 44.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1272
- ORF length:
- 1206
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ccgcctgacg gagagcgagg cgcgccggca gcagcagcag ctcctgcagc 121 cgcggccctc gcccgtgggc agcagcgggc ccgagccccc cggggggcag cccgacggca 181 tgaaggacct ggacgccatc aaactcttcg tgggccagat cccgcggcac ctggacgaga 241 aggacctcaa gccgctcttg gagcagttcg gccgcatcta cgagctcacg gtgctcaaag 301 acccctacac ggggatgcac aaaggctgtg ccttcctcac ctactgtgcc agggattccg 361 ccatcaaagc tcagactgcc ctgcacgagc agaagacctt gcccggaatg gcgcggccaa 421 tccaggtgaa gcctgcggac agtgaaagcc gcggaggtag ggaccggaag ctgttcgtgg 481 ggatgctgaa caagcagcag tcggaggagg acgtgctgcg gctgttccag cccttcgggg 541 tcattgacga gtgcacagtg ctccgggggc ctgacggcag cagcaaaggc tgtgctttcg 601 tgaagttctc ctcccacacg gaggcgcagg cggccatcca cgccttgcat gggagccaga 661 ccatgccggg agcctcctcc agcctggtgg tcaagttcgc cgacacggac aaggagcgga 721 cgctccggcg catgcagcag atggtgggcc agctgggcat cctgacgccg tccctcacat 781 tgcccttcag cccctacagt gcctacgccc aggctctcat gcaacagcag acaacagtcc 841 tgtccacctc gggcagctac ctgagtcccg gcgtggcctt ctcaccctgt cacatccagc 901 agataggcgc cgtcagcctc aacgggctgc ctgccacacc catcgctcct gccTCTGGGC 961 TGCACTCACC CCCGCTGCTG GGCACCACCG CTGTGCCTGG CCTCGTGGCT CCCATCACCA 1021 ATGGCTTTGC AGGTGTCGTG CCCCTTTCCA GGTGGGCACC CTGCCCTGGA AACCGTCTAT 1081 GCCAATGGCC TTGTGCCCTA CCCAGCTCAG AGCCCGACTG TGGCCGAGAC ACTGCATCCT 1141 GCCTTCTCCG GAGTCCAGCA GTACACAGCC ATGTACCCCA CCGCGGCCAT CACGCCCATC 1201 GCGCACAGCG TCCCCCAGCC GCCGCCCCTC CTGCAGCAGC AGCAGCGAGA AGGAGTTTGG 1261 AGACACGGAG CTGCCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1321 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1381 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGACTT AGCCTAGCTG ATTATTTGTT 1441 AACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t