Transcript: Human XR_430147.1

PREDICTED: Homo sapiens CUGBP Elav-like family member 5 (CELF5), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CELF5 (60680)
Length:
3554
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_430147.1
NBCI Gene record:
CELF5 (60680)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_430147.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074429 CGGCAATATCATTTCCTCCAA pLKO.1 1292 3UTR 100% 2.640 3.696 N CELF5 n/a
2 TRCN0000422174 ACTTTGGGTTGACTCGGTTTG pLKO_005 3358 3UTR 100% 6.000 4.800 N CELF5 n/a
3 TRCN0000418320 TGGTGTTCCTGTTACGTGTTT pLKO_005 3418 3UTR 100% 4.950 3.960 N CELF5 n/a
4 TRCN0000436666 ATTTCTGCTACGAGTAATTTC pLKO_005 3263 3UTR 100% 13.200 9.240 N CELF5 n/a
5 TRCN0000074430 CGGCTTCGTGAGCTTTGATAA pLKO.1 1352 3UTR 100% 13.200 9.240 N CELF5 n/a
6 TRCN0000420531 AGGCTGTGCTTTCGTGAAGTT pLKO_005 586 3UTR 100% 4.950 3.465 N CELF5 n/a
7 TRCN0000074428 CGTGATTTGTACAATGTACTT pLKO.1 3241 3UTR 100% 4.950 3.465 N CELF5 n/a
8 TRCN0000424040 ATGCAACAGCAGACAACAGTC pLKO_005 818 3UTR 100% 4.050 2.835 N CELF5 n/a
9 TRCN0000432820 GAAGCCTGCGGACAGTGAAAG pLKO_005 427 3UTR 100% 3.600 2.520 N CELF5 n/a
10 TRCN0000074432 TCCTCCAAGGTGTTTATGGAT pLKO.1 1305 3UTR 100% 3.000 2.100 N CELF5 n/a
11 TRCN0000433706 AGTCCAGCAGTACACAGCCAT pLKO_005 1150 3UTR 100% 2.640 1.848 N CELF5 n/a
12 TRCN0000429984 AGTTTGGAGACACGGAGCTGA pLKO_005 1252 3UTR 100% 2.640 1.848 N CELF5 n/a
13 TRCN0000074431 GCCAGGGATTCCGCCATCAAA pLKO.1 347 3UTR 100% 1.875 1.313 N CELF5 n/a
14 TRCN0000426038 CCTGGACGCCATCAAACTCTT pLKO_005 187 3UTR 100% 4.950 2.970 N CELF5 n/a
15 TRCN0000424182 AGCTACCAACCAGAGCAAGTG pLKO_005 1328 3UTR 100% 4.050 2.430 N CELF5 n/a
16 TRCN0000247429 AGCAGTACACAGCCATGTATC pLKO_005 1155 3UTR 100% 10.800 7.560 N Celf5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_430147.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08804 pDONR223 100% 39.3% None (many diffs) n/a
2 ccsbBroad304_08804 pLX_304 0% 39.3% V5 (many diffs) n/a
3 TRCN0000470282 TAGTGTCAACTCCATCTTCCCAAA pLX_317 21.8% 39.3% V5 (many diffs) n/a
4 ccsbBroadEn_14239 pDONR223 100% 33.8% None (many diffs) n/a
5 ccsbBroad304_14239 pLX_304 0% 33.8% V5 (many diffs) n/a
6 TRCN0000465239 CTTAGCCTAGCTGATTATTTGTTA pLX_317 26.8% 33.8% V5 (many diffs) n/a
Download CSV